Structure and expression of rat osteosarcoma

Alkaline phosphatase [ALP; orthophosphoric-monoester phosphohydrolase (alkaline optimum), EC 3.1.3.1] is a ubiquitous enzyme of unknown function expressed at high levels in cells of mineralizing tissues. To study the structure, function, and expression of ALP, a full-length cDNA of rat ALP (2415 bases) was isolated from a ROS 17/2.8 osteosarcoma cell XgtlO cDNA library. The predicted amino acid sequence spans 524 residues and includes an N-terminal signal peptide of 17 amino acids, the phosphohydrolase active site, a rather hydrophilic backbone with five potential Nglycosylation sites, and a short hydrophobic C-terminal sequence. ALP negativeCHO cells transfected with an expression vector containing the ALP coding sequences express ALP. The rat bone, liver, and kidney ALP shows remarkable 90% homology with the corresponding human enzyme, the most divergent region being the C-terminal hydrophobic domain through which the enzyme may be anchored to the plasma membrane. The rat ALP also shows 50% homology with the human placental and intestinal ALP and 25% homology with the Escherichia coli ALP. The amino acids involved in catalysis show nearly complete homology among all known ALP sequences, suggesting that these enzymes evolved from a common ancestral gene. The rat ALP cDNA pRAP 54, used as a hybridization probe in RNA blot analysis of several tissues that express ALP, revealed the presence ofan ALPmRNA of =2500 bases. Furthermore, hybridization patterns derived from Southern blot analysis of rat chromosomal DNA offered molecular evidence that the ALP expressed in ROS 17/2.8 osteosarcoma and various rat tissues, excluding the intestine, is the product of the same single copy gene. Alkaline phosphatase [ALP; orthophosphoric-monoester phosphohydrolase (alkaline optimum), EC 3.1.3.1] is a ubiquitous nonspecific phosphomonoesterase synthesized by many vertebrate cells (1). The enzyme is a 68to 82-kDa, zinc-containing, plasma membrane-bound glycoprotein localized on the extracellular surface (2). High levels of ALP activity are found in small intestine, kidney, placenta, and in mineralizing tissue such as bone (3), calcifying cartilage (4, 5), dentine, and enamel (6), while low levels of the enzyme are found in most other types of cells. In calcifying cartilage, a substantial fraction of the ALP is found in extracellular matrix vesicles; these appear to arise from chondrocyte plasma membranes, and microscopic evidence suggests that they nucleate the initial deposition of minerals (7-9). Especially high levels of ALP activity are found in osteoblasts, where increased activity is associated with osteoblastic maturation, bone formation, and bone turnover (10). Two biochemically and immunochemically distinct forms of ALP are known in the rat: an intestinal form and the bone/liver/kidney/placenta (BLKP) form (11-13). The available evidence suggests that these two forms of the enzyme are encoded by two distinct genetic loci (14, 15). N-terminal sequencing of purified ALP from rat placenta, kidney, calvaria, and osteosarcoma (ROS 17/2.8) cells are identical, supporting the view that they are the products of the same gene (16). Recent studies have shown that the synthesis of osteoblast ALP is under the control of 1,25-dihydroxyvitamin D3 (17), parathyroid hormone (18, 19), ,3-adrenergic agents (18, 19), and glucocorticoids (20). However, a detailed molecular study of the regulation of ALP gene expression during osteoblast development and calcification has been hampered by the lack of specific full-length nucleic acid probes and sequence information. We report here the isolation of a full-length cDNA and the analysis of the deduced amino acid sequence of rat BLKP ALP.§ This cDNA probe hybridizes with equal sized mRNA in rat liver, kidney, lung, placenta, and osteosarcoma cells. Moreover, Southern blots of rat chromosomal DNA revealed that the rat BLKP enzyme is indeed the product of a unique single copy gene, distinct from the gene encoding the intestinal enzyme. MATERIALS AND METHODS Reagents. A cDNA synthesis kit, Hybond-N, and the [a-32P]dNTPs were purchased from Amersham. EcoRI-digested XgtlO arms, Gigapack, and pBS/M13+ (Bluescribe) were obtained from Stratagene. DH5a cells were purchased from Bethesda Research Laboratories. T4 DNA ligase, T4 polynucleotide kinase, and all restriction enzymes were obtained from Boehringer Mannheim. EcoRI methylase, S-adenosylmethionine, and a Maxam and Gilbert (21) sequencing kit were from New England Biolabs. Construction and Screening of a ROS 17/2.8 XgtlO cDNA Library. Double-stranded cDNA was constructed from poly(A)+ RNA from rat osteosarcoma (ROS 17/2.8) cells using the protocol of Gubler and Hoffman (22). The procedures for the construction and plaque screening of the XgtlO library have been described by Huynh et al. (23). The recombinant phage preparation was amplified once through C600 hflcells. Plaque DNA was transferred to Hybond-N nylon filters and hybridizations were performed according to the manufacturer. The EcoRI insert of pRAPi (24), used as a hybridization probe, was labeled with 32P by the method of Feinberg and Vogelstein (25). Subcloning and Sequencing of pRAP cDNA. Phage DNA from positive clones was prepared according to Silhavy et al. (26), digested with EcoRI, and ligated to EcoRI-digested Abbreviations: ALP, alkaline phosphatase; BLK, bone/liver/ kidney; BLKP, bone/liver/kidney/placenta. tTo whom reprint requests should be addressed. §This sequence is being deposited in the EMBL/GenBank data base (Bolt, Beranek, and Newman Laboratories, Cambridge, MA, and Eur. Mol. Biol. Lab., Heidelberg) (accession no. J03572). 319 The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact. Proc. Natl. Acad. Sci. USA 85 (1988) pBS/M13+ DNA. The ligation products were used to transform DH5a cells. The cDNA sequences were generated by the method ofMaxam and Gilbert (21) and analyzed using the IntelliGenetics computer programs. Transfection and Measurement of ALP Activity. The 2054base-pair (bp) EcoRI/Bgl II fragment of pRAP54 was made blunt-ended with Klenow and inserted into the Sma I site of pECE (27), which was the generous gift of W. J. Rutter (University of California, San Francisco). Transfection was carried out by the DEAE-dextran method (28). The ALP activity was measured 72 hr after transfection from 2.5% of cell extracts. The specific activity of ALP was calculated as nmol ofp-nitrophenyl phosphate hydrolyzed per min per mg of total protein (20). Histochemical staining of ALP was carried out using Naphthol AS-MX phosphate (Sigma). RNA Blot Analysis. Total RNA was prepared essentially as described by Chirgwin et al. (29). RNA was subjected to electrophoresis through a 1% agarose gel containing 2.2 M formaldehyde and transferred to a sheet of Hybond-N (30). The blot was prehybridiztd and hybridized at 420C in a buffer containing 50% (vol/vol) formamide according to the manufacturer. The blots were washed with 0.1x SSC (lx SSC = 0.15 M NaCI/0.015 M sodium citrate)/0.1% NaDodSO4 at 650C. Southern Blot Analysis. Large molecular weight DNA was prepared from rat spleen as described (31), digested with restriction enzymes, separated by electrophoresis through 0.8% agarose gels, and transferred to nylon membranes according to Southern (32). The 32P-labeled restriction fragments of pRAP54 used for this study are outlined in Fig. 5. The prehybridization, hybridization, and washing conditions used for the preparation of these blots were identical to those used for plaque hybridization. RESULTS AND DISCUSSION Isolation and Sequence Analysis of Full-Length Rat BLKP ALP cDNA. Recently, Noda et al. (24) reported the isolation of pRAP1 and pRAP2 from a ROS 17/2.8 Xgtll cDNA library using a human BLK ALP cDNA (33) as a hybridization probe. Together, hese two cDNAs contain sequences that span 600 bases of the 3' noncoding sequence of the rat BLKP ALP mRNA. We constructed a XgtlO library from ROS 17/2.8 poly(A)+ RNA and using pRAP1 as a hybridization probe, isolated five ALP cDNAs with inserts ranging from 1000 to 2400 bp from a sample of =106 plaques. Both strands of the largest cDNA, pRAP54, were sequenced by the method of Maxam and Gilbert (21). Fig. 1 shows the DNA sequence of pRAP54 and the deduced amino acid sequence of the rat BLKP ALP molecule. The cDNA includes 152 bases of 5' noncoding sequence, a 1572-base open reading frame, and the 3' noncoding sequence. Immediately upstream from the initiation codon is a sequence that is strongly homologous with the consensus sequence suggested to be involved in the initiation of translation of eukaryotic mRNA (34). The bulk of the 3' noncoding sequence has been presented elsewhere (24) and is omitted in our figure. The 3' sequences reported previously (pRAP1 and pRAP2) did not contain a putative AATAAA polyadenylylation sequence, but two such sequences can be found at the 3' end of the pRAP54 molecule. The second polyadenylylation sequence could be an artifact since the last several adenyl residues in the nucleotide sequence may represent the first residues of the poly(A) tract. The ALP mRNA of 2.5 kilobase pairs (kbp) observed in ROS 17/2.8 cells would be generated by the addition of -100 adenyl residues (35) to the 3' end of the 2415-base cDNA sequence, which suggests that the pRAP54 sequence is essentially full-length. CACGGCGCTCCTTAGGGCCACCGCTCGGCGCCCCOGGACAGACCCTCCCCACTCCTCCCTGCA 63 GGATCGGAACGTCAATTAACGGCTCACACTGCCCCCCACCTCTTCCCACCCATCTGGGCTCCAGcGAC4cGGCATCTGGAcTACACC 152 A1G A/C Ml aM TffTTEkS CM CM A[C Mk OTIM l CIT XXC AAC 1 = WI ak QCG AAA Wt AAA GkC CC ACT XIS 7; CQk aC 215 14 SW Tr =M 1 Am CkA OM ak Gin AM MI AAA AAT OM: CO AAA =S Ml AAA (CIACA^CDJZ AMI Mll Q A* AID SC JAE AM TIC C ak GE CM 1a: M8 u__ 1 > 1 _ 45 Tyr (au Val OMGEIMACMA = XI Mr OM ACM ATC Cr AAGGCa=C0A ac W0C AAC AM GAD GW Q| AM X: CMEW MOG Gl A*AlC TV( 431 Am ho TI EUGE TI~M A^GACGWA40ACCAAIC U OCMUGW AM MWM=CACTrCU NC M = GE A*COMA SR GGCW GZ ASUMAMGM OMACG=G GE (M AM MASACXCAZCT AAC W WAM UMCC(MIM ACA 617 i tQ~ A l1V01 BD ac Ul (n: A*C IM GE a( AMCM ImAC ACC AMT CM GE AAC a: acAU auc Aq oamxC OM WXM OM WCMT XW IM 70 IVC IM GoC AX GOG AE1 ac Mkx Ul CM cmKC G =C XC A*AGJ tl an TAT aW(KG M AC TIACMA*GSC GAO am W G B CAlGSToz;aEA~oA^GNrzC=AAGA£ACTGIk GIGG^ATG^ACMWlAA*sCACAAUXID~kMa a r _ _ _~~~~~~_ _b:1s~_ 3 MY SW ~ DDDt~S IsG i 2 _X ~~~~~~~~~~~~~~~~~D hl*FT~~~~~~r QCrTM~ AT MA0AA MA aria kg